Jan
Last seen: Today
13.455 total contributions since 2009It is easier to solve a problem than to guess, what the problem is.
Questions about FileExchange submissions are welcome - get my address from the code. I do not answer mails concerning questions in the forum.
Jan's Badges
Download any 10 unique submissions
Awarded to Jan on 01 Apr 2021
Your submissions were downloaded 250 or more times in a month
Awarded to Jan on 01 Nov 2019
Your submission is selected as "Pick of The Week"
Awarded to Jan on 09 Oct 2019
Publish your first comment or rating
Awarded to Jan on 09 Oct 2019
Your submissions received 25 five star ratings
Awarded to Jan on 09 Oct 2019
Publish your first submission
Awarded to Jan on 09 Oct 2019
Reach 25000 reputation points
Awarded to Jan on 14 Aug 2018
Answer 50 questions that were unanswered for more than 30 days
Awarded to Jan on 14 Aug 2017
Contribute at least one answer each month for 36 consecutive months
Awarded to Jan on 20 Jul 2017
Accept 50 answers given by other contributors
Awarded to Jan on 20 Jul 2017
100 of your answers have been accepted
Awarded to Jan on 20 Jul 2017
Provide your first answer ever to someone else's question
Awarded to Jan on 20 Jul 2017
Like a problem or solution
Awarded to Jan on 27 Jan 2012
Comment on a problem or solution
Awarded to Jan on 26 Jan 2012
Solve a problem for the first time
Awarded to Jan on 26 Jan 2012
Transparency violation error. Using 'eval' in a 'parfor' loop
Some general hints: load() without catching its output to a variable creates variables dynamically in the workspace. This imped...
ein Tag ago | 1
Matrix multiplication to get covariance matrix
No, there is no chance for a significant speedup or vectorization, because the result of the former iteration is the input of th...
ein Tag ago | 0
Run the same script for multiple folders
See: FAQ: How to access a sequence of files FolderList = dir('C:\Your\BaseFolder\'): FolderList = FolderList([FolderList.isdir...
ein Tag ago | 0
How to create a 7*9 black and white image by using 0 and 1?
T = [0, 0, 0, 0, 0, 0, 0, 0, 0; ... 0, 1, 1, 1, 0, 1, 1, 1, 0; ... 0, 0, 1, 0, 0, 1, 0, 1, 0; ... 0, 0, 1, 0, ...
ein Tag ago | 1
How to perfrom indexing on nested cell array ?
Are you aware that cellfun looks really nice, but that the code runs faster with loops? In your case you see, that a simple loo...
ein Tag ago | 1
| accepted
Using index to name variables
Do not create variables names dynamically. This would store information in the names, where it is hard to access. Use the values...
ein Tag ago | 0
| accepted
Need help for "error using -mex file"
The message means, that the subfolder "gsl/" cannot be found. Then provide its base folder by the -I parameter. See: https://www...
ein Tag ago | 0
| accepted
Filter function in MATLAB
Did you read the documentation already? doc filter doc filtfilt filter() introduces a delay between input and output signals,...
ein Tag ago | 0
different reactions to right/left click
Comparing char vectors by == fails, if the number of characters is not equal. '123' == 'abc' % Working '1234' == '0' % W...
ein Tag ago | 0
| accepted
How do I fix the "A METHODS block or END might be missing before the function definition. This might be causing additional error messages." issue.
The conditions are not recognized in the "elseif" commands. If you really want to move them to the next line, insert the line co...
ein Tag ago | 1
Random line segments confined in a box
figure; axes('XLim', [-0.1, 1.1], 'YLim', [-0.1, 1.1]); nLine = 100; Coor = [0, 1, 1, 0, 0; ... 0, 0, 1, 1, 0]; for...
2 Tage ago | 2
| accepted
How to save data from edit text using a push button in a GUI?
"With a pushbutton I want to close the GUI and save all the data from the edit boxes." Closing is easy: close(handle.figure1) ...
2 Tage ago | 1
| accepted
readtable interpretes time hh:mm:ss:SSS in different ways
I do not understand the meaning of your file operations. As far as I understand, the problem can be reproduced by: RA = readtab...
2 Tage ago | 0
| accepted
While loops in ode45
You do not reset erro to inf after the first iteration. Then all following iterations are not entered. Replace: erro = inf; ....
2 Tage ago | 0
Coupled differential equation using ODE 45
Yes, of course the values are 0. The initial value of y(1) is 0. The derivative of y(1) is: dwp0dz = ((s * alpha0 * y(1) * x0)...
2 Tage ago | 1
| accepted
How can I make sphere using smaller spheres?
r = 0.1; R = 1; [x, y, z] = sphere(12); w = linspace(-R + r, R - r, 1 + R / r); figure; axes('NextPlot', 'add', 'XLim', [-R...
2 Tage ago | 2
| accepted
How to assign a row matrix to another row matrix
The error message suggests: To convert to numeric, use the TABLE2ARRAY function Did you try this already? In one line you w...
2 Tage ago | 0
Insert an input to an exe automatically by Command Window
You could use this to inject keystrokes: https://www.mathworks.com/matlabcentral/fileexchange/40001-keyinject The function must...
2 Tage ago | 1
| accepted
ODE45 function time step
Avoid using global variables, because they are a shot in your knee. Use a persistent variable instead and reply it to the calle...
2 Tage ago | 0
Repeating while loop until the conditions are met
It is not getting clear to me, what you are asking for. So some hints at first: Pi=0; sumPi=0; P=zeros(n,1); for j=1:n ...
3 Tage ago | 0
Turn off "Improve MATLAB by sending user experience" from the command line
What about setting this parameter through the GUI and comparing C:\Users\<USER>\AppData\Roaming\MathWorks\MATLAB\<VErSION>\mat...
3 Tage ago | 0
How to create an array from a GUI where the array length changes by user's input?
The easiest way is to omit step 1, but to let the use create as many values as wanted and count them afterwards. There is a nice...
3 Tage ago | 1
| accepted
How to Count occurrences?
t = 'tagtacagccagtagagttgattccaaggaagtccggctgttgtagagtagc'; tag = 'tag'; result = sum(strfind(lower(t), lower(tag)))
3 Tage ago | 1
several plot - subplot for-loop
Maybe: ... subplot(1, length(Files), k); yyaxis left plot(p,ODsatpercent,'bo--'); yyaxis right pl...
3 Tage ago | 1
How to doI plot F(x) = [1 -(10/x)]/[1-(100/x^2)] for X ranging from 100 to 1100 at an interval of 50?
x = 100:50:1100; plot(x, (1 - (10 ./ x)) ./ (1 - (100 ./ x.^2))); With some basic maths skills, a simplification is easy: plo...
3 Tage ago | 2
How to change output in FOR Loop
Creating variables dynamically has a lot of severe disadvantaged. Using a struct is nicer, safer and more efficient. X = {'JanL...
3 Tage ago | 0
Mis-type append problem
The problem is, that you provide CHAR vectors, but scatter requires numerical arrays. readtable would be smart, but this works ...
4 Tage ago | 0
Error using ode45
The error message means, that you need a function, because the integrator uses input and output arguments for the function to be...
6 Tage ago | 0
| accepted
How to solve this ODE system which involves these integrals?
What about using two further variables? function dx = fcn(z, x) dx = [f1(x(1), x(2)) / x(3); ... f2(x(1), x(2)) / x(4);...
6 Tage ago | 0
| accepted
Select a Web Site
Choose a web site to get translated content where available and see local events and offers. Based on your location, we recommend that you select: .
Select web siteYou can also select a web site from the following list:
Americas
- América Latina (Español)
- Canada (English)
- United States (English)
Europe
- Belgium (English)
- Denmark (English)
- Deutschland (Deutsch)
- España (Español)
- Finland (English)
- France (Français)
- Ireland (English)
- Italia (Italiano)
- Luxembourg (English)
- Netherlands (English)
- Norway (English)
- Österreich (Deutsch)
- Portugal (English)
- Sweden (English)
- Switzerland
- United Kingdom (English)