Community Profile



Last seen: Today
13.455 total contributions since 2009

It is easier to solve a problem than to guess, what the problem is.

Questions about FileExchange submissions are welcome - get my address from the code. I do not answer mails concerning questions in the forum.

Jan's Badges

  • Explorer
  • Personal Best Downloads Level 4
  • Editor's Pick
  • First Review
  • 5-Star Galaxy Level 5
  • First Submission
  • Grand Master
  • Revival Level 4
  • 36 Month Streak
  • Thankful Level 4
  • Knowledgeable Level 4
  • First Answer
  • Promoter
  • Commenter
  • Solver

View details...

Contributions in
View by

Transparency violation error. Using 'eval' in a 'parfor' loop
Some general hints: load() without catching its output to a variable creates variables dynamically in the workspace. This imped...

ein Tag ago | 1

Matrix multiplication to get covariance matrix
No, there is no chance for a significant speedup or vectorization, because the result of the former iteration is the input of th...

ein Tag ago | 0

Run the same script for multiple folders
See: FAQ: How to access a sequence of files FolderList = dir('C:\Your\BaseFolder\'): FolderList = FolderList([FolderList.isdir...

ein Tag ago | 0

How to create a 7*9 black and white image by using 0 and 1?
T = [0, 0, 0, 0, 0, 0, 0, 0, 0; ... 0, 1, 1, 1, 0, 1, 1, 1, 0; ... 0, 0, 1, 0, 0, 1, 0, 1, 0; ... 0, 0, 1, 0, ...

ein Tag ago | 1

How to perfrom indexing on nested cell array ?
Are you aware that cellfun looks really nice, but that the code runs faster with loops? In your case you see, that a simple loo...

ein Tag ago | 1

| accepted

Using index to name variables
Do not create variables names dynamically. This would store information in the names, where it is hard to access. Use the values...

ein Tag ago | 0

| accepted

Need help for "error using -mex file"
The message means, that the subfolder "gsl/" cannot be found. Then provide its base folder by the -I parameter. See: https://www...

ein Tag ago | 0

| accepted

Filter function in MATLAB
Did you read the documentation already? doc filter doc filtfilt filter() introduces a delay between input and output signals,...

ein Tag ago | 0

different reactions to right/left click
Comparing char vectors by == fails, if the number of characters is not equal. '123' == 'abc' % Working '1234' == '0' % W...

ein Tag ago | 0

| accepted

How do I fix the "A METHODS block or END might be missing before the function definition. This might be causing additional error messages." issue.
The conditions are not recognized in the "elseif" commands. If you really want to move them to the next line, insert the line co...

ein Tag ago | 1

Random line segments confined in a box
figure; axes('XLim', [-0.1, 1.1], 'YLim', [-0.1, 1.1]); nLine = 100; Coor = [0, 1, 1, 0, 0; ... 0, 0, 1, 1, 0]; for...

2 Tage ago | 2

| accepted

while loop in matlab
What's wrong with while true in Matlab?

2 Tage ago | 2

| accepted

How to save data from edit text using a push button in a GUI?
"With a pushbutton I want to close the GUI and save all the data from the edit boxes." Closing is easy: close(handle.figure1) ...

2 Tage ago | 1

| accepted

readtable interpretes time hh:mm:ss:SSS in different ways
I do not understand the meaning of your file operations. As far as I understand, the problem can be reproduced by: RA = readtab...

2 Tage ago | 0

| accepted

While loops in ode45
You do not reset erro to inf after the first iteration. Then all following iterations are not entered. Replace: erro = inf; ....

2 Tage ago | 0

Coupled differential equation using ODE 45
Yes, of course the values are 0. The initial value of y(1) is 0. The derivative of y(1) is: dwp0dz = ((s * alpha0 * y(1) * x0)...

2 Tage ago | 1

| accepted

How can I make sphere using smaller spheres?
r = 0.1; R = 1; [x, y, z] = sphere(12); w = linspace(-R + r, R - r, 1 + R / r); figure; axes('NextPlot', 'add', 'XLim', [-R...

2 Tage ago | 2

| accepted

How to assign a row matrix to another row matrix
The error message suggests: To convert to numeric, use the TABLE2ARRAY function Did you try this already? In one line you w...

2 Tage ago | 0

Insert an input to an exe automatically by Command Window
You could use this to inject keystrokes: The function must...

2 Tage ago | 1

| accepted

ODE45 function time step
Avoid using global variables, because they are a shot in your knee. Use a persistent variable instead and reply it to the calle...

2 Tage ago | 0

Repeating while loop until the conditions are met
It is not getting clear to me, what you are asking for. So some hints at first: Pi=0; sumPi=0; P=zeros(n,1); for j=1:n ...

3 Tage ago | 0

Turn off "Improve MATLAB by sending user experience" from the command line
What about setting this parameter through the GUI and comparing C:\Users\<USER>\AppData\Roaming\MathWorks\MATLAB\<VErSION>\mat...

3 Tage ago | 0

How to create an array from a GUI where the array length changes by user's input?
The easiest way is to omit step 1, but to let the use create as many values as wanted and count them afterwards. There is a nice...

3 Tage ago | 1

| accepted

How to Count occurrences?
t = 'tagtacagccagtagagttgattccaaggaagtccggctgttgtagagtagc'; tag = 'tag'; result = sum(strfind(lower(t), lower(tag)))

3 Tage ago | 1

several plot - subplot for-loop
Maybe: ... subplot(1, length(Files), k); yyaxis left plot(p,ODsatpercent,'bo--'); yyaxis right pl...

3 Tage ago | 1

How to doI plot F(x) = [1 -(10/x)]/[1-(100/x^2)] for X ranging from 100 to 1100 at an interval of 50?
x = 100:50:1100; plot(x, (1 - (10 ./ x)) ./ (1 - (100 ./ x.^2))); With some basic maths skills, a simplification is easy: plo...

3 Tage ago | 2

How to change output in FOR Loop
Creating variables dynamically has a lot of severe disadvantaged. Using a struct is nicer, safer and more efficient. X = {'JanL...

3 Tage ago | 0

Mis-type append problem
The problem is, that you provide CHAR vectors, but scatter requires numerical arrays. readtable would be smart, but this works ...

4 Tage ago | 0

Error using ode45
The error message means, that you need a function, because the integrator uses input and output arguments for the function to be...

6 Tage ago | 0

| accepted

How to solve this ODE system which involves these integrals?
What about using two further variables? function dx = fcn(z, x) dx = [f1(x(1), x(2)) / x(3); ... f2(x(1), x(2)) / x(4);...

6 Tage ago | 0

| accepted

Load more