How to get all possible rearrange permutations of array with repeated elements?
2 Ansichten (letzte 30 Tage)
Ältere Kommentare anzeigen
I have some DNA sequences to rearrange
'ACTCACATCTGGTTCCTCTA'
and I need all possible permutations of this (4 'A', 7 'T', 7 'C', 2 'G'). For example,
'AAAATTTTTTTCCCCCCCGG',
'AAATATTTTTTCCCCCCCGG',
'AATAATTTTTTCCCCCCCGG',
...
I used
unique(perms('ACTCACATCTGGTTCCTCTA'),'rows');
It works for smaller array. But for this array, it results error because perms with 20 elements takes up too much memory ( numel is 20! = 2.43e+18).
Actual numbers of permutation would be 20!/4!/7!/7!/2! = 2.00e+09. It's a lot, but still it fits on my memory.
So is there any better way?
0 Kommentare
Akzeptierte Antwort
Weitere Antworten (0)
Siehe auch
Kategorien
Mehr zu Matrices and Arrays finden Sie in Help Center und File Exchange
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!