Binary to DNA sequence encoding - matlab

13 Ansichten (letzte 30 Tage)
Meghashree G
Meghashree G am 20 Sep. 2015
Kommentiert: Image Analyst am 5 Feb. 2021
I am implementing DNA encryption algorithm.
For that, I have a vector containing binary values such as:
01100011 01110010 01111001 01110000 01110100 01101111.
Now, these values should be mapped to DNA sequence. How do I do that in MATLAB?
  2 Kommentare
Star Strider
Star Strider am 20 Sep. 2015
DNA has four bases (two complementary sets, A-T and C-G) and you have a binary sequence ...
Meghashree G
Meghashree G am 20 Sep. 2015
yeah..i know To use ATGC concept,but i don't know how to code..Like how do i extract only 2 digits from the binary vector and assign it to either A,T,G,C..

Melden Sie sich an, um zu kommentieren.

Akzeptierte Antwort

Image Analyst
Image Analyst am 20 Sep. 2015
Perhaps this:
% Assign sample data.
binaryArray = [0,1,1,0,0,0,1,1, 0,1,1,1,0,0,1,0, 0,1,1,1,1,0,0,1, 0,1,1,1,0,0,0,0, 0,1,1,1,0,1,0,0, 0,1,1,0,1,1,1,1];
% Define base letters to choose from.
bases = 'ATGC';
for k = 1 : 2 : length(binaryArray)
% Convert these two digits into a number 1 - 4.
index = 2 * binaryArray(k) + binaryArray(k+1) + 1;
% Use that index to assign a letter to our result.
result((k+1)/2) = bases(index);
end
% Display in command window:
result
It shows:
result =
TGACTCAGTCGTTCAATCTATGCC
  12 Kommentare
Shiva Reddy
Shiva Reddy am 5 Feb. 2021
Pls Can I get the decryption code
Image Analyst
Image Analyst am 5 Feb. 2021
Shiva, I'm not sure who you're asking, but personally I don't have any to give you.

Melden Sie sich an, um zu kommentieren.

Weitere Antworten (0)

Kategorien

Mehr zu Cell Arrays finden Sie in Help Center und File Exchange

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!

Translated by