Community Profile

photo

Ahmad


UST

16 total contributions since 2015

Contact

Ahmad's Badges

  • Thankful Level 1

View details...

Contributions in
View by

Question


Help me understand code to draw the nullclines
The code can be found here: <https://www.math.uwaterloo.ca/~bingalls/MMSB/Code/matlab/symmetric_network.m>

mehr als 3 Jahre ago | 0 answers | 0

0

answers

Question


Matlab index in range yet I get out of range
I'm trying to extract the model parameters using: clc clear all data = xlsread('cancer_train.xlsx'); X = data(...

mehr als 3 Jahre ago | 1 answer | 0

1

answer

Question


How to plot this function in matlab?
x=e^((y-b)/a)

etwa 4 Jahre ago | 2 answers | 0

2

answers

Question


Function handle is giving wrong results!
This code is clearly giving wrong results: clc;clear all a0 = 2; a1 = 2; y = [1 1.4 2.3]; x = [1 2 3]; f = @...

etwa 4 Jahre ago | 2 answers | 0

2

answers

Question


How to draw a log function?
I love function handles in matlab, I can do this for example: f = @(x,a,b) a*(x.^b); plot(x,f(x,a,b)); This is so use...

mehr als 4 Jahre ago | 3 answers | 0

3

answers

Question


Multiple conditions for while loop.
while (Ea0 >= 0.01)&&(Ea0 >= 0.01)||(Sr >= 10^-4) This loop keeps on going even though the first part (Ea0 >= 0.01)&&(...

mehr als 4 Jahre ago | 1 answer | 0

1

answer

Question


How to change the name of the program, and GUI.fig
My friend did the GUI part of this program, I'd appreciate if you told me how to change the name, and a quick overview of it and...

mehr als 5 Jahre ago | 1 answer | 0

1

answer

Question


Formating and tweaking output
I need to achieve three more things with my program: 1. Make dots appear slowly to correspond to the time it takes for an op...

mehr als 5 Jahre ago | 0 answers | 0

0

answers

Answered
Take input and use it in a function
Thank you so much

mehr als 5 Jahre ago | 0

Question


Take input and use it in a function
I''m trying to write a program that can analyze protein relationship. I'm trying to make the user input the accession number of ...

mehr als 5 Jahre ago | 2 answers | 0

2

answers

Question


Please debug this code for me
I'm trying to make a program based on this tutorial: http://www.mathworks.com/help/bioinfo/examples/using-scoring-matrices-to...

mehr als 5 Jahre ago | 0 answers | 0

0

answers

Question


Please fix this code
protein1=input('Please input GenPept code of the first protein: ', 's'); protein2=input('Please input GenPept code of the s...

mehr als 5 Jahre ago | 2 answers | 0

2

answers

Question


Plz explain this code to me!
Hello, I'm trying to understand a program that identifies recognition sites for restriction enzymes of a DNA sequence, and outpu...

mehr als 5 Jahre ago | 0 answers | 0

0

answers

Answered
Why doesn't this matlab code work?!
thank u so much for offering help, i understand what a cell array is now, but i don't understand thsis syntax "y{1}", and sorry ...

mehr als 5 Jahre ago | 0

Answered
Why doesn't this matlab code work?!
couldn't understand what it says, plus i'm trying to add this line too, can u fix it: cut_position= strfind(s,y) + x -2; i...

mehr als 5 Jahre ago | 0

Question


Why doesn't this matlab code work?!
s={'CCCAGCTCCCGAATTCCCCAGCTA'}; rec={'AG^CT'}; x=strfind(rec,'^'); y=rec; y(x)=[] I get: Error using su...

mehr als 5 Jahre ago | 4 answers | 0

4

answers