Window length Selection size for DNA sequence?
Ältere Kommentare anzeigen
i have a DNA sequence like
ATTCGATTGCCCAATTGGCTTATCCAATACTGGGA and wanna read the DNA sequcnce on a window size 5 ,10 and 15 so how to do this?? please drop a code
Antworten (0)
Kategorien
Mehr zu Genomics and Next Generation Sequencing finden Sie in Hilfe-Center und File Exchange
am 28 Jan. 2019
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!
Translated by 
