Window length Selection size for DNA sequence?
2 Ansichten (letzte 30 Tage)
Ältere Kommentare anzeigen
i have a DNA sequence like
ATTCGATTGCCCAATTGGCTTATCCAATACTGGGA and wanna read the DNA sequcnce on a window size 5 ,10 and 15 so how to do this?? please drop a code
0 Kommentare
Antworten (0)
Siehe auch
Kategorien
Mehr zu Genomics and Next Generation Sequencing finden Sie in Help Center und File Exchange
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!