how to import gene fasta file from NCBI using matlab 2016a
7 Ansichten (letzte 30 Tage)
Ältere Kommentare anzeigen
Priyanka Roy
am 28 Feb. 2017
Kommentiert: Paola Favaretto
am 1 Mär. 2017
I want to import gene fasta file from NCBI database using the Accession Number. I use the code Data = getgenbank('NP_752927.1'); but, getting this error : Error using getncbidata (line 191) The key NP_752927.1 was not found in the nucleotide database at this time. Please check that the input is a valid accession number or try again.
NOTE: This function is dependent on NCBI's Entrez tools and sequence databases. Changes to either may cause this function to break.
Error in getgenbank (line 70)
[varargout{1:nargout}] = getncbidata(accessnum,'fileformat','GenBank','database','nucleotide',varargin{:});
How will i resolve the error?
0 Kommentare
Akzeptierte Antwort
Paola Favaretto
am 28 Feb. 2017
Are you sure it is a valid accession number? When I search the NCBI databases with the id you provided, I get 0 results.
Weitere Antworten (1)
Paola Favaretto
am 1 Mär. 2017
Bearbeitet: Paola Favaretto
am 1 Mär. 2017
What version of Bioinformatics Toolbox are you using? I am able to download the sequence without issues.
You can get the sequence information by typing:
a = getgenbank('NC_002695', 'sequenceonly', true)
Or you can save the sequence in a FASTA formatted file by typing:
a = getgenbank('NC_002695', 'tofile', 'S:/myfile2.fa', 'fileformat', 'fasta')
This is a snippet of the output:
a =
struct with fields:
Header: 'NC_002695.1 Escherichia coli O157:H7 str. Sakai, complete genome'
Sequence: 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTCTCTGACAGC ...'
4 Kommentare
Paola Favaretto
am 1 Mär. 2017
See if this patch solves your problem. (NCBI switched their protocol to https in late September 2016).
If not, I suggest you contact MathWorks Customer Support to get the help you need to solve your particular problem.
Siehe auch
Kategorien
Mehr zu Data Import and Export finden Sie in Help Center und File Exchange
Produkte
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!