Hauptinhalt

bioinfo.pipeline.block.UserFunction

R2026b

Bioinformatics pipeline block to call custom function

Since R2023a

  • userfunction block icon

Description

A UserFunction block enables you to use any existing or custom function as a block in your pipeline, similar to any other built-in blocks.

Creation

Description

ufBlock = bioinfo.pipeline.block.UserFunction creates a UserFunction block.

example

ufBlock = bioinfo.pipeline.block.UserFunction(fcn) creates a UserFunction block from a custom function fcn, which can be a function handle, name of an existing or custom function, or function signature string.

example

ufBlock = bioinfo.pipeline.block.UserFunction(fcn,Name=Value) sets some of the block properties using one or more name-value arguments. fcn must be a function handle or name of a function.

Input Arguments

expand all

Custom function, specified as a function handle, string or character vector representing the name of a function.

Data Types: char | string | function_handle

Name-Value Arguments

expand all

Specify optional pairs of arguments as Name1=Value1,...,NameN=ValueN, where Name is the argument name and Value is the corresponding value. Name-value arguments must appear after other arguments, but the order of the pairs does not matter.

Example: blosumBlock = UserFunction(@blosum62, OutputArguments="Matrix") specifies to create a UserFunction block for the blosum62 function using the string "Matrix" as the name of the block output port.

Names of the required positional input arguments for the custom function fcn, specified as a string, character vector, string vector, or cell array of character vectors. The order of arguments specified in this property is the same order used to call the underlying function fcn. The specified names are used as the names of required input ports of the block.

The corresponding input ports of the UserFunction block have the Required property set to true to indicate that these ports are required and must be satisfied.

Names of the output arguments returned by the custom function fcn, specified as a string, character vector, string vector, or cell array of character vectors.

Names of the optional name-value arguments for the custom function fcn, specified as a string, character vector, string vector, or cell array of character vectors.

The corresponding input ports of the UserFunction block have the Required property set to false to indicate that these ports are optional.

Properties

expand all

Function to handle errors from the run method of the block, specified as a function handle. The handle specifies the function to call if the run method encounters an error within a pipeline. For the pipeline to continue after a block fails, ErrorHandler must return a structure that is compatible with the output ports of the block. The error handling function is called with the following two inputs:

  • Structure with these fields:

    FieldDescription
    identifierIdentifier of the error that occurred
    messageText of the error message
    indexLinear index indicating which block process failed in the parallel run. By default, the index is 1 because there is only one run per block. For details on how block inputs can be split across different dimensions for multiple run calls, see Bioinformatics Pipeline SplitDimension.

  • Input structure passed to the run method when it fails

Data Types: function_handle

Flag to forward the run folder location to the underlying function, specified as numeric or logical 1 (true) or 0 (false).

The default value is false to avoid forwarding the run folder or working folder location to the underlying function. If the value is true, the run folder information is forwarded to the underlying function, which uses the location to save the output files. However, you must first update the underlying function to accept the RunFolder name-value argument. For an example implementation such a UserFunction block, see Specify Run Folder Location for UserFunction.

Data Types: double | logical

Function to evaluate when you run the block, specified as a function handle, string scalar, or character vector that represents the name of any custom function.

When you call the run method with an input structure, it converts the input structure to positional and name-value arguments as determined by the Signature property and runs the specified function with those converted inputs. For examples, see Create UserFunction Blocks For MATLAB Functions.

Data Types: char | string | function_handle

This property is read-only.

Input ports of the block, specified as a structure. The field names of the structure are the names of the block input ports, and the field values are bioinfo.pipeline.Input objects. These objects describe the input port behaviors. The input port names are the expected field names of the input structure that you pass to the block run method.

Data Types: struct

Name-value arguments for the block Function, specified as a string scalar, character vector, string vector, or cell array of character vectors. If you provide multiple name-value arguments, the UseFunction block sorts and stores them alphabetically.

Data Types: char | string | cell

Names of the output arguments of the block Function, returned as a string scalar, character vector, string vector, or cell array of character vectors. The order of these names determines the order of outputs returned by the block.

The specified names are used as the names of required output ports of the block. Changing this property for an existing UserFunction block renames the block output ports and resets the order and number of output ports to match the new value.

Data Types: char | string | cell

This property is read-only.

Output ports of the block, specified as a structure. The field names of the structure are the names of the block output ports, and the field values are bioinfo.pipeline.Output objects. These objects describe the output port behaviors. The field names of the output structure returned by the block run method are the same as the output port names.

Data Types: struct

Names of the required positional input arguments to the block Function, specified as a string scalar, character vector, string vector, or cell array of character vectors. The order of these names determines the order that the inputs are passed to the block Function when you call the block run method.

The specified names are used as the names of required input ports of the block. Changing this property for an existing UserFunction block renames the block input ports and resets the order and number of input ports to match the new value.

Data Types: char | string | cell

Block Function signature, specified as a string scalar or character vector. The Signature property defines how the underlying custom function is called when you run the block. In other words, the signature is typically similar to what you would enter at the MATLAB® command line to run such a function. For example, the Signature to run the aa2int function with one input and one output argument would be: "numbers = aa2int(Seq)", where numbers is an output variable and Seq is an input variable. For examples, see Create UserFunction Blocks For MATLAB Functions.

If you specify the Signature property, other related properties, namely, Function, RequiredArguments, NameValueArguments, and OutputArguments, are automatically derived and set. Ensure that the signature you specify is a valid MATLAB expression containing one function call.

Data Types: char | string

Object Functions

compilePerform block-specific additional checks and validations
copyCopy array of handle objects
emptyInputsCreate input structure for use with run method
evalEvaluate block object
runRun block object

Examples

collapse all

You can create a UserFunction block for any existing or custom MATLAB function.

Create UserFunction for size Function

Create a UserFunction block for the size function with a single input and output.

ufSize = bioinfo.pipeline.block.UserFunction;
ufSize.Function = "size";
ufSize.RequiredArguments = "A";
ufSize.OutputArguments = "sz"
ufSize = 
  UserFunction with properties:

             Signature: "sz = size(A)"
     RequiredArguments: "A"
    NameValueArguments: [0×0 string]
       OutputArguments: "sz"
              Function: @size
                Inputs: [1×1 struct]
               Outputs: [1×1 struct]
          ErrorHandler: []

The UserFunction block is created. Next, create an input structure with the field name matching the input port name "A".

inStruct = struct("A",ones(2,3));

Run the block using the input structure. The block result is returned as a structure with the field named "sz", which matches the output port on the block.

sizeResult = run(ufSize,inStruct)
sizeResult = struct with fields:
    sz: [2 3]

Create UserFunction for align2cigar Function

Create a UserFunction block for the align2cigar function with two inputs and two outputs.

ufalign2cigar = bioinfo.pipeline.block.UserFunction;
ufalign2cigar.Function          = "align2cigar";
ufalign2cigar.RequiredArguments = ["alignment","ref"];
ufalign2cigar.OutputArguments   = ["cigars","starts"]
ufalign2cigar = 
  UserFunction with properties:

             Signature: "[cigars, starts] = align2cigar(alignment, ref)"
     RequiredArguments: [2×1 string]
    NameValueArguments: [0×1 string]
       OutputArguments: [2×1 string]
              Function: @align2cigar
                Inputs: [1×1 struct]
               Outputs: [1×1 struct]
          ErrorHandler: []

The UserFunction block is created with two input ports and two output ports, which are named after the inputs (alignment and ref) and outputs (cigars and starts) that you specified.

ufalign2cigar.RequiredArguments
ans = 2×1 string array
    "alignment"
    "ref"

ufalign2cigar.OutputArguments
ans = 2×1 string array
    "cigars"
    "starts"

Use emptyInputs to create an input structure with the fields automatically named after the block input ports.

inStruct = emptyInputs(ufalign2cigar)
inStruct = struct with fields:
    alignment: []
          ref: []

Set the values of the structure fields.

inStruct.alignment = ['ACG-ATGC'; 'ACGT-TGC'; '  GTAT-C'];
inStruct.ref       = 'ACGTATGC';

Run the block with the input structure. The block results are returned as a structure with the fields cigars and starts.

a2cResults = run(ufalign2cigar,inStruct)
a2cResults = struct with fields:
    cigars: {'3=1D4='  '4=1D3='  '4=1D1='}
    starts: [1 1 3]

Create UserFunction for samread

Create a UserFunction block for the samread function that takes in multiple name-value arguments.

ufsamread = bioinfo.pipeline.block.UserFunction;
ufsamread.Function = "samread";
ufsamread.RequiredArguments  = "File";
ufsamread.OutputArguments    = ["samData","headerData"];
ufsamread.NameValueArguments = ["blockread","tags"]
ufsamread = 
  UserFunction with properties:

             Signature: "[samData, headerData] = samread(File, 'blockread', blockreadValue, 'tags', tagsValue)"
     RequiredArguments: "File"
    NameValueArguments: [2×1 string]
       OutputArguments: [2×1 string]
              Function: @samread
                Inputs: [1×1 struct]
               Outputs: [1×1 struct]
          ErrorHandler: []

Use emptyInputs with IncludeOptional=true so that the structure has the fields for the required input (File) and optional name-value arguments (blockread and tags).

inStruct = emptyInputs(ufsamread,IncludeOptional=true)
inStruct = struct with fields:
         File: []
    blockread: []
         tags: []

Set the input values. For the File input, use the provided SAM file. Read a block of sequence entries from 5 to 10 and exclude the tags.

inStruct.File = which("ex1.sam");
inStruct.blockread = [5 10];
inStruct.tags = false;

Run the block. The results are returned as a structure. samData field contains sequence alignment and mapping information from the SAM file. headerData contains the header information about the SAM file.

results = run(ufsamread,inStruct)
results = struct with fields:
       samData: [6×1 struct]
    headerData: [1×1 struct]

results.samData(1)
ans = struct with fields:
            QueryName: 'EAS56_59:8:38:671:758'
                 Flag: 137
        ReferenceName: 'seq1'
             Position: 9
       MappingQuality: 99
          CigarString: '35M'
    MateReferenceName: '*'
         MatePosition: 0
           InsertSize: 0
             Sequence: 'GCTCATTGTAAATGTGTGGTTTAACTCGTCCATGG'
              Quality: '<<<<<<<<<<<<<<<;<;7<<<<<<<<7<<;:<5%'

results.headerData.SequenceDictionary
ans = struct with fields:
        SequenceName: 'seq1'
    GenomeAssemblyID: 'HG18'
      SequenceLength: 62435964

Import the Pipeline and block objects needed for the example.

import bioinfo.pipeline.Pipeline
import bioinfo.pipeline.block.*

Create a pipeline.

qcpipeline = Pipeline;

Select an input FASTQ file using a FileChooser block.

fastqfile = FileChooser(which("SRR005164_1_50.fastq"));

Create a SeqFilter block.

sequencefilter = SeqFilter;

Define the filtering threshold value. Specifically, filter out sequences with a total of more than 10 low-quality bases, where a base is considered a low-quality base if its quality score is less than 20.

sequencefilter.Options.Threshold = [10 20];

Add the blocks to the pipeline.

addBlock(qcpipeline,[fastqfile,sequencefilter]);

Connect the output of the first block to the input of the second block. To do so, you need to first check the input and output port names of the corresponding blocks.

View the Outputs (port of the first block) and Inputs (port of the second block).

fastqfile.Outputs
ans = struct with fields:
    Files: [1×1 bioinfo.pipeline.Output]

sequencefilter.Inputs
ans = struct with fields:
    FASTQFiles: [1×1 bioinfo.pipeline.Input]

Connect the Files output port of the fastqfile block to the FASTQFiles port of sequencefilter block.

connect(qcpipeline,fastqfile,sequencefilter,["Files","FASTQFiles"]);

Next, create a UserFunction block that calls the seqqcplot function to plot the quality data of the filtered sequence data. In this case, inputFile is the required argument for the seqqcplot function. The required argument name can be anything as long as it is a valid variable name.

qcplot = UserFunction("seqqcplot",RequiredArguments="inputFile",OutputArguments="figureHandle");

Alternatively, you can also use dot notation to set up your UserFunction block.

qcplot = UserFunction;
qcplot.RequiredArguments = "inputFile";
qcplot.Function = "seqqcplot";
qcplot.OutputArguments = "figureHandle";

Add the block.

addBlock(qcpipeline,qcplot);

Check the port names of sequencefilter block and qcplot block.

sequencefilter.Outputs
ans = struct with fields:
    FilteredFASTQFiles: [1×1 bioinfo.pipeline.Output]
         NumFilteredIn: [1×1 bioinfo.pipeline.Output]
        NumFilteredOut: [1×1 bioinfo.pipeline.Output]

qcplot.Inputs
ans = struct with fields:
    inputFile: [1×1 bioinfo.pipeline.Input]

Connect the FilteredFASTQFiles port of the sequencefilter block to the inputFile port of the qcplot block.

connect(qcpipeline,sequencefilter,qcplot,["FilteredFASTQFiles","inputFile"]);

Run the pipeline to plot the sequence quality data.

run(qcpipeline);

seqqcplot_figure.png

Suppose you have a custom function that writes a table to a file in the current folder.

function fileName = saveTable(tbl)
   fileName = "output.csv";
   writetable(tbl,fileName);
end

You can create a UserFunction block that uses saveTable as the block function. You can control the run folder location, where the output files are saved, using the ForwardRunFolder property of the block. But you must update the underlying function saveTable to accept the RunFolder name-value argument first.

function fileName = saveTable(tbl, NVPArgs)
   arguments
      tbl
      NVPArgs.RunFolder = "."
   end
   fileName = fullfile(NVPArgs.RunFolder, "output.csv");
   writetable(tbl, fileName);
end

Create a sample table to write to the output file: output.csv.

LastName = ["Sanchez";"Johnson";"Li";"Diaz";"Brown"];
Age = [38;43;38;40;49];
Height = [71;69;64;67;64];
tbl = table(LastName, Age, Height);

Create a UserFunction block that calls the saveTable function.

uf = bioinfo.pipeline.block.UserFunction;
uf.RequiredArguments = "T";
uf.OutputArguments = "File";
uf.Function = @saveTable;
uf.ForwardRunFolder = true;

Specify the run folder location where the output file will be saved.

folderLocation = "C:\Examples\tmp\ufFolder";

Create an input structure to use as an input for the block run function.

inStruct = struct("T",tbl);

Run the UserFunction block by specifying the input structure and the run folder location. The run folder location is then forwarded to the underlying function saveTable, which uses that location to save the output file.

outStruct = run(uf,inStruct,RunFolder=folderLocation)
outStruct = struct with fields:
    File: "C:\Examples\tmp\ufFolder\output.csv"

Check the contents of the generated output file.

readtable(outStruct.File)
ans = 5×3 table
    'Sanchez'    38    71
    'Johnson'    43    69
         'Li'    38    64
       'Diaz'    40    67
      'Brown'    49    64

Version History

Introduced in R2023a

expand all