Decoding DNA sequence into binary
53 Ansichten (letzte 30 Tage)
Ältere Kommentare anzeigen
Meghashree G
am 23 Sep. 2015
Bearbeitet: Khaled belkacemi
am 4 Apr. 2022
I have a sequence TGACTCAGTCGTTCAATCTATGCC, how to write code in matlab to convert it into binary? Please help me..Thank you
3 Kommentare
Dabba Do
am 14 Feb. 2018
Bearbeitet: Dabba Do
am 14 Feb. 2018
IF: every A matches to a T, THEN: the output for an A or a T is the same. The same is true of G and C they are a pair. So there are only two pairs, why not try defining each pair as a 1 or a 0. So if A and T = 1 and G and C = 0 then: the sequence TGACTCAGTGTTCAATCTATGCC would be: 101010101001101110111000. By coding each codon with a 1 and a 0 you are going to con-volute the Bits in your code and they work as pairs representing a single genetic Bit.
Akzeptierte Antwort
James Tursa
am 23 Sep. 2015
Bearbeitet: James Tursa
am 23 Sep. 2015
One way:
s = 'TGACTCAGTCGTTCAATCTATGCC'; % Input DNA string
[~,x] = ismember(s,'ATGC'); % Convert the ATGC into indexes
c = {'00','01','10','11'}; % Numeric strings to convert the indexes into
result = cell2mat(c(x)); % Convert the indexes into the numeric strings
Weitere Antworten (4)
Bastien Chardonnens
am 23 Sep. 2015
You can use
str = ('TGACTCAGTCGTTCAATCTATGCC');
[~,~,ind] = unique(double(str)-65);
dec2bin(ind-1)
0 Kommentare
Suresma Jena
am 27 Aug. 2017
i want to how to convert a DNA sequence into binary. ex- if x = ATGCAT then its binary sequence will be xA = 100010 xT = 010001 xG = 001000 xC = 000100
6 Kommentare
lakshmi boddu
am 8 Apr. 2018
A pseudo random binary sequence of size 256 * 256 is generated with two 1 D logistic maps , from which 3-bit disjoint and consecutive binary sequences are extracted to choose DNA coding rule, as follows 000 ( 00-A,01-C 10-G,11-T) 001(00-A,01-G,10-C,11-T) 010(00-C,01-A,10-T,11-G) 011( 00-C ,01-T,10-A,11-G) 100( 00-G, 01-A,10-T,11-C) 101(00-G,01-T,10-A, 11-C) 110(00-T,01-C,10-G,11-A) 111( 00-T,01-G,10-C,11-A) . please help me sir how to implement in matlab
Siyab Khan
am 15 Jan. 2019
Bearbeitet: Siyab Khan
am 15 Jan. 2019
Please also write code for DNA sequencig in 4 bits
via this given schema
4 2 1 0
N = 0 0 0 1 N represents the gap in DNA sequence
A = 0 1 0 0
T = 1 0 0 0
C = 0 0 1 0
G = 0 1 1 0
0 Kommentare
Khaled belkacemi
am 4 Apr. 2022
Bearbeitet: Khaled belkacemi
am 4 Apr. 2022
Hello,can someone help me to do the code for this situation? example of input data:0121212002202021101110002
and i want to code my data as this array
0 Kommentare
Siehe auch
Kategorien
Mehr zu Genomics and Next Generation Sequencing finden Sie in Help Center und File Exchange
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!