Community Profile

photo

Siyab Khan


5 total contributions since 2019

Siyab Khan's Badges

  • First Answer

View details...

Contributions in
View by

Question


how to find accuracy from confusion matrix having 4 x4 dimensions
I have used the following function for finding confusion matrix c=confusionmat(x,y) it gives me output like that , C = ...

5 Monate ago | 0 answers | 0

0

answers

Question


Pleas tell me how to solve the Error in the Code?
this given below is the code if Interior Search Algorith with Back propagation i want results like this Epoch=1 Time=1.40838 ...

5 Monate ago | 0 answers | 0

0

answers

Question


Window length Selection size for DNA sequence?
i have a DNA sequence like ATTCGATTGCCCAATTGGCTTATCCAATACTGGGA and wanna read the DNA sequcnce on a window size 5 ,10 and 15 s...

7 Monate ago | 0 answers | 0

0

answers

Answered
How to decide window size for a moving average filter?
How can we select a wind size for the selection of DNA sequence like ATCGGGCTTACGG window length size 5 to read the sequence...

7 Monate ago | 0

Answered
Decoding DNA sequence into binary
Please also write code for DNA sequencig in 4 bits via this given schema 4 2 1 0 N = 0 0 0 1 N repre...

7 Monate ago | 0