Cody

Problem 79. DNA N-Gram Distribution

Solution 2823378

Submitted on 12 Aug 2020 by Jonas
This solution is locked. To view this solution, you need to provide a solution of the same size or smaller.

Test Suite

Test Status Code Input and Output
1   Pass
s = 'AACTGAACG'; n = 3; hifreq_correct = 'AAC'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

ordered = 1×5 cell array {'AAC'} {'ACT'} {'CTG'} {'GAA'} {'TGA'} pos = 1 2 3 5 4 1 hifreq = 'AAC'

2   Pass
s = 'dynamic routing service'; n = 2; hifreq_correct = 'ic'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

ordered = 1×20 cell array Columns 1 through 18 {' r'} {' s'} {'am'} {'c '} {'dy'} {'er'} {'g '} {'ic'} {'in'} {'mi'} {'na'} {'ng'} {'ou'} {'ro'} {'rv'} {'se'} {'ti'} {'ut'} Columns 19 through 20 {'vi'} {'yn'} pos = 5 20 11 3 10 8 4 1 14 13 18 17 9 12 7 2 16 6 15 19 8 hifreq = 'ic'

3   Pass
s = 'Your veracity is exceeded by your sagacity.'; n = 5; hifreq_correct = 'acity'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

ordered = 1×37 cell array Columns 1 through 13 {' by y'} {' exce'} {' is e'} {' saga'} {' vera'} {' your'} {'Your '} {'acity'} {'agaci'} {'by yo'} {'ceede'} {'city '} {'d by '} Columns 14 through 26 {'ded b'} {'ed by'} {'eded '} {'eeded'} {'eraci'} {'excee'} {'gacit'} {'is ex'} {'ity i'} {'our s'} {'our v'} {'r sag'} {'r ver'} Columns 27 through 37 {'racit'} {'s exc'} {'sagac'} {'ty is'} {'ur sa'} {'ur ve'} {'verac'} {'xceed'} {'y is '} {'y you'} {'your '} pos = 7 24 32 26 5 33 18 27 8 12 22 30 35 3 21 28 2 19 34 11 17 16 14 15 13 1 10 36 6 37 23 31 25 4 29 9 20 8 hifreq = 'acity'

4   Pass
s = 'AGCGAAGGAAGGATCACATTTCTCAGGACAAAGGCATTTCACTAATGGTT'; n = 3; hifreq_correct = 'AGG'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

ordered = 1×31 cell array Columns 1 through 16 {'AAA'} {'AAG'} {'AAT'} {'ACA'} {'ACT'} {'AGC'} {'AGG'} {'ATC'} {'ATG'} {'ATT'} {'CAA'} {'CAC'} {'CAG'} {'CAT'} {'CGA'} {'CTA'} Columns 17 through 31 {'CTC'} {'GAA'} {'GAC'} {'GAT'} {'GCA'} {'GCG'} {'GGA'} {'GGC'} {'GGT'} {'TAA'} {'TCA'} {'TCT'} {'TGG'} {'TTC'} {'TTT'} pos = 6 22 15 18 2 7 23 18 2 7 23 20 8 27 12 4 14 10 31 30 28 17 27 13 7 23 19 4 11 1 2 7 24 21 14 10 31 30 27 12 5 16 26 3 9 29 25 hifreq = 'AGG'

5   Pass
s = 'In short, in matters vegetable, animal, and mineral, I am the very model of a modern Major-General.'; n = 2; hifreq_correct = 'er'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

ordered = 1×68 cell array Columns 1 through 18 {' I'} {' M'} {' a'} {' i'} {' m'} {' o'} {' s'} {' t'} {' v'} {', '} {'-G'} {'Ge'} {'I '} {'In'} {'Ma'} {'a '} {'ab'} {'aj'} Columns 19 through 36 {'al'} {'am'} {'an'} {'at'} {'bl'} {'d '} {'de'} {'e '} {'e,'} {'eg'} {'el'} {'en'} {'er'} {'et'} {'f '} {'ge'} {'he'} {'ho'} Columns 37 through 54 {'im'} {'in'} {'jo'} {'l '} {'l,'} {'le'} {'m '} {'ma'} {'mi'} {'mo'} {'n '} {'nd'} {'ne'} {'ni'} {'od'} {'of'} {'or'} {'r-'} Columns 55 through 68 {'ra'} {'rn'} {'rs'} {'rt'} {'ry'} {'s '} {'sh'} {'t,'} {'ta'} {'te'} {'th'} {'tt'} {'ve'} {'y '} pos = 14 47 7 61 36 53 58 62 10 4 38 47 5 44 22 66 64 31 57 60 9 67 28 34 32 63 17 23 42 27 10 3 21 50 37 44 19 41 10 3 21 48 24 5 45 38 49 31 55 19 41 10 1 13 3 20 43 8 65 35 26 9 67 31 59 68 5 46 51 25 29 40 6 52 33 3 16 5 46 51 25 31 56 47 2 15 18 39 53 54 11 12 30 49 31 55 19 hifreq = 'er'

Suggested Problems

More from this Author95

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!